#1 2010-10-19 17:11:57

 Wiktor

Użytkownik

7204678
Zarejestrowany: 2010-10-19
Posty: 2
Punktów :   

BLASTN.txt

Zamieszczam plik BLASTN.txt, wszyscy dostaliście go na email, ale co tam.

BLASTN.TXT

Kod:

>1
ggcggggcctgcttctcctcagcttcaggcggctgcgacgagccctcaggcgaacctctcggctttcccgcgcggcgccgcctcttg
ctgcgcctccgcctcctcctctgctccgccaccggcttcctcctcctgagcagtcagcccgcgcgccggccggctccgttatggcgac
ccgcagccctggcgtcgtgattagtgatgatgaaccaggttatgaccttgatttattttgcatacctaatcattatgctgaggatttggaaag
ggtgtttattcctcatggactaattatggacaggactgaacgtcttgctcgagatgtgatgaaggagatgggaggccatcacattgtagc
cctctgtgtgctcaaggggggctataaattctttgctgacctgctggattacatcaaagcactgaatagaaatagtgatagatccattccta
tgactgtagattttatcagactgaagagctattgtaatgaccagtcaacaggggacataaaagtaattggtggagatgatctctcaacttta
actggaaagaatgtcttgattgtggaagatataattgacactggcaaaacaatgcagactttgctttccttggtcaggcagtataatccaaa
gatggtcaaggtcgcaagcttgctggtgaaaaggaccccacgaagtgttggatataagccagactttgttggatttgaaattccagacaa
gtttgttgtaggatatgcccttgactataatgaatacttcagggatttgaatcatgtttgtgtcattagtgaaactggaaaagcaaaatacaaa
gcctaagatgagagttcaagttgagtttggaaacatctggagtcctattgacatcgccagtaaaattatcaatgttctagttctgtggccatc
tgcttagtagagctttttgcatgtatcttctaagaattttatctgttttgtactttagaaatgtcagttgctgcattcctaaactgtttatttgcactat
gagcctatagactatcagttccctttgggcggattgttgtttaacttgtaaatgaaaaaattctcttaaaccacagcactattgagtgaaacat
tgaactcatatctgtaagaaataaagagaagatatattagttttttaattggtattttaatttttatatatgcaggaaagaatagaagtgattgaa
tattgttaattataccaccgtgtgttagaaaagtaagaagcagtcaattttcacatcaaagacagcatctaagaagttttgttctgtcctggaa
ttattttagtagtgtttcagtaatgttgactgtattttccaacttgttcaaattattaccagtgaatctttgtcagcagttcccttttaaatgcaaatc
aataaattcccaaaaatttaaaaaaaaaaaaaaaaaaaaaa

>2
gcggccgcaccccccggccgggccgtgcttctgcccctacaaggtttgggccgaggtgggggagggtcctggttgccggccccgc
ccggtccctccccgccttttaggcgcccgcgtggccgggacgtcccagtcccgctccgtcctcctcgcctgccaccggtgcacccagt
ccgctcacccagcccagtccgtccggtcctcaccgcctgccggccggcccaccccccaccgcagccatggacgccatcaagaaga
agatgcagatgctgaagctggacaaggagaacgccatcgaccgcgccgagcaggccgaagccgacaagaagcaagctgaggac
cgctgcaagcagctggaggaggagcagcaggccctccagaagaagctgaaggggacagaggatgaggtggaaaagtattctgaat
ccgtgaaggaggcccaggagaaactggagcaggccgagaagaaggccactgatgctgaggcagatgtggcctccctgaaccgcc
gcattcagctggttgaggaggagctggaccgggcccaggagcgcctggctacagccctgcagaagctggaggaggccgagaagg
cggctgatgagagcgagagaggaatgaaggtcatcgaaaaccgggccatgaaggatgaggagaagatggaactgcaggagatgc
agctgaaggaggccaagcacatcgctgaggattcagaccgcaaatatgaagaggtggccaggaagctggtgatcctggaaggaga
gctggagcgctcggaggagagggctgaggtggccgagagtaaatgtggggacctagaggaggagctgaaaattgttaccaacaact
tgaaatccctggaggcccaggcggacaagtattccaccaaagaagataaatatgaagaggagatcaaactgttggaggagaagctga
aggaggctgagacccgagcagagtttgccgagaggtctgtggcaaagttggagaaaaccatcgatgacctagaagatgaagtctatg
cccagaagatgaagtacaaggccattagcgaggaactggacaacgcactcaatgacatcacctccctctgagccccacgccagcgtg
gccacctcagctctcttctctcctctcctttccattctctctatggggaggggagcaggcaggaggagcagaaattgccaacattgcaca
gccaggctgggagcagcctagggagagcccccatcatgcccaccacccactctggcactggcttcatcctttacctatccccttccacc
ctcctttgctgcttaataaattctgaacttggtctcca

>3
ccaccgcagcggacagcgccaagtgaagcctcgcttcccctccgcggcgaccagggcccgagccgagagtagcagttgtagctac
ccgcccagaaactagacacaatgtgcgacgaagacgagaccaccgccctcgtgtgcgacaatggctccggcctggtgaaagccgg
cttcgccggggatgacgcccctagggccgtgttcccgtccatcgtgggccgcccccgacaccagggcgtcatggtcggtatgggtca
gaaagattcctacgtgggcgacgaggctcagagcaagagaggtatcctgaccctgaagtaccctatcgagcacggcatcatcaccaa
ctgggatgacatggagaagatctggcaccacaccttctacaacgagcttcgcgtggctcccgaggagcaccccaccctgctcaccga
ggcccccctcaatcccaaggccaaccgcgagaagatgacccagatcatgtttgagaccttcaacgtgcccgccatgtacgtggccatc
caggccgtgctgtccctctacgcctccggcaggaccaccggcatcgtgctggactccggcgacggcgtcacccacaacgtgcccat
ttatgagggctacgcgctgccgcacgccatcatgcgcctggacctggcgggccgcgatctcaccgactacctgatgaagatcctcact
gagcgtggctactccttcgtgaccacagctgagcgcgagatcgtgcgcgacatcaaggagaagctgtgctacgtggccctggacttc
gagaacgagatggcgacggccgcctcctcctcctccctggaaaagagctacgagctgccagacgggcaggtcatcaccatcggcaa
cgagcgcttccgctgcccggagacgctcttccagccctccttcatcggtatggagtcggcgggcattcacgagaccacctacaacagc
atcatgaagtgtgacatcgacatcaggaaggacctgtatgccaacaacgtcatgtcggggggcaccacgatgtaccctgggatcgctg
accgcatgcagaaagagatcaccgcgctggcacccagcaccatgaagatcaagatcatcgccccgccggagcgcaaatactcggtg
tggatcggcggctccatcctggcctcgctgtccaccttccagcagatgtggatcaccaagcaggagtacgacgaggccggcccttcc

atcgtccaccgcaaatgcttctagacacactccacctccagcacgcgacttctcaggacgacgaatcttctcaatgggggggcggctg
agctccagccaccccgcagtcactttctttgtaacaacttccgttgctgccatcgtaaactgacacagtgtttataacgtgtacatacattaa
cttattacctcattttgttatttttcgaaacaaagccctgtggaagaaaatggaaaacttgaagaagcattaaagtcattctgttaagctgcgt
aaaaaaaaaaaaaaaaaaa

>4
tggattgaaagcttagcctggtaaactattcccagctaaatggcatacgacgcatattaaacccacatccgagattaagatgcctattagg
ctttcaccgagcgctagaagattgataatgctccccccattaatggttgatttatcaatgattaaggggagttgtgagctaatgattaaccct
tggctaccgagtagattaattagacccatgagtagtttcgcattgatggagagtag

>5
cctgcgtggctgggctgctcgggttagatcgtcaggaaaagcctaaagattagactgtaagaaaagaaaatagaagccatgtttcgaa
gacctgtattacaggtacttcgtcagtttgtaagacatgagtccgaaacaactaccagtttggttcttgaaagatccctgaatcgtgtgcac
ttacttgggcgagtgggtcaggaccctgtcttgagacaggtggaaggaaaaaatccagtcacaatattttctctagcaactaatgagatg
tggcgatcaggggatagtgaagtttaccaactgggtgatgtcagtcaaaagacaacatggcacagaatatcagtattccggccaggcct
cagagacgtggcatatcaatatgtgaaaaaggggtctcgaatttatttggaagggaaaatagactatggtgaatacatggataaaaataa
tgtgaggcgacaagcaacaacaatcatagctgataatattatatttctgagtgaccagacgaaagagaaggagtagaaaggatgattctt
ctttggccatcatttggtacagtctcatttccaagtcatgtataatctttatggcttccaaggacaagaattaaaatactcttttacgt

Ostatnio edytowany przez Wiktor (2010-10-19 17:13:25)

Offline

 

#2 2010-10-20 17:23:02

olka

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 3
Punktów :   

Re: BLASTN.txt

http://blast.ncbi.nlm.nih.gov/Blast.cgi … =BlastHome podaję link do strony, która rozkminia ten plik. niestety, otrzymałam jakieś kosmiczne wyniki i ja ich nie ogarniam. może będziecie mieli więcej szczęścia

Offline

 

#3 2010-10-20 20:12:48

Gosia

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 7
Punktów :   

Re: BLASTN.txt

Ola,
na pierwszy rzut oka faktycznie mozna tego nie ogarnac - pomalu, opisz co widzisz :-).
Gosia

Offline

 

#4 2010-10-20 23:04:25

Grzesiek

Użytkownik

Zarejestrowany: 2010-10-19
Posty: 1
Punktów :   

Re: BLASTN.txt

mi się udało jedynie odnaleść, że jest to kod kwasu nukleinowego, konkretniej nazywa się on chyba fosforybozylotransferaza hipoksantynowo-guaninowa (http://pl.wikipedia.org/wiki/Fosforyboz … -guaninowa). z wikipedii można odczytać, że jest to enzym do odzyskiwania puryny ze zdegradowanego DNA.
ponadto program wypisuje, że jest to mRNA, co wydaje się dość dziwne ze względu na obecność tyminy w kodzie. wypisuje też, że kod ma długość 1435. nic więcej na razie nie widzę, ale ciągle czegoś szukam.

Offline

 

#5 2010-10-21 10:00:05

Gosia

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 7
Punktów :   

Re: BLASTN.txt

Chyba muszę Wam podpowiedzieć, że każdą sekwencję (1,2,3,4,5) trzeba traktować osobno.
Grzesiek stwierdził, że któraś sekwencja odpowiada sekwencji genu HPRT - to jest pierwsza sekwencja - O.K., to jest to. Co z kolejnymi?
Grzesiek, to że w sekwencji pisze, że jest mRNA, a widzisz tyminy, to jest to skrót myślowy osoby, która dodawała sekwencję do bazy danych - chciała w ten sposób dać znać do zrozumienia, że podana sekwencja jest odpowiednikiem mRNA, bo nie zawiera intronów.
Gosia

Offline

 

#6 2010-10-21 19:52:17

olka

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 3
Punktów :   

Re: BLASTN.txt

ok, idąc tym tropem, sprawdziłam 2 sekwencję. też jest to kwas nukleinowy. dokładnie cDNA, czyli DNA uzyskany przez odwrotną transkrypcję na matrycy mRNA uzyskanego z kom. wklejam link - http://pl.wikipedia.org/wiki/CDNA prawdobodobnie należy do bydła domowego (bos taurus) , makaka jawajskiego (Macaca fascicularis), bo takie nazwy się tam pojawiały

Offline

 

#7 2010-10-21 21:12:29

Gosia

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 7
Punktów :   

Re: BLASTN.txt

Jakbyś szukała w bazie DNA ludzkiego (http://blast.ncbi.nlm.nih.gov/Blast.cgi … =blasthome) to znalazłabyś, że sekwencja jest 100% identyczna z genem kodującym tropomiozynę ludzką. To, że znalazłaś podobieństwo do makaka i krowy ;-) to nie jest nic dziwnego, ostatecznie ludzie są spokrewnieni z innymi zwierzętami ;-)
Moje pytanie do Was (gdzie się podziewa reszta śledczych?), a zarazem podpowiedź:
1. Co z resztą sekwencji (mamy już pierwszą i drugą)? Czy wszystkie sekwencje znajdują swoje odpowiedniki w bazie danych?
2. Co to znaczy, że sekwencja koduje?

Gosia

Offline

 

#8 2010-10-22 19:06:46

olka

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 3
Punktów :   

Re: BLASTN.txt

załatwiłam już wszystkie sekwencje:
sekwencja 3 to aktyna, mRNA, długość 1509,
sekwencja 4 ma po 2 chromosomy 14, 4 i 1 ; długość 240,
sekwencja 5 to jednoniciowe DNA (SSBP1)

Offline

 

#9 2010-10-22 20:38:42

Gosia

Użytkownik

Zarejestrowany: 2010-10-20
Posty: 7
Punktów :   

Re: BLASTN.txt

O.K. Podsumujmy:
1. Sekwencja 1 koduje gen HPRT, 2 - tropomiozynę, 3- aktynę, 5-białko wiążące jednoniciowe DNA
2. Sekwencja nr 4 nie koduje niczego (przynajmniej jak ja ją wrzucam do programu, to oddaje mi, że "no significant similarities found").

Proponuję się skupić na sekwencji 4. Skoro nie jest podobna do niczego w bazie danych, to może jest w niej zakodowana jakaś informacja od Wiesława Tipsa.

Gosia

Offline

 

Stopka forum

RSS
Powered by PunBB
© Copyright 2002–2008 PunBB
Polityka cookies - Wersja Lo-Fi


Darmowe Forum | Ciekawe Fora | Darmowe Fora
ogame na poczatku lepiej rozbudowywac kopalnie ? przeziebiony pies duzo sika co to jest zly nawiew kobiety z darmowymi numerami telefonu zamość przestałam się uczyć